Bu Reklamı Kapat
Bu Reklamı Kapat

DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!

DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin! Big Think
10 dakika
12,283
  • Evrimsel Biyoloji
  • Moleküler Biyoloji ve Genetik
Evrim Ağacı Akademi: Evrimi Anlamak Yazı Dizisi

Bu yazı, Evrimi Anlamak yazı dizisinin 7. yazısıdır. Bu yazı dizisini okumaya, serinin 1. yazısı olan ""Tesadüf" Geliyor, Kaçın! Bilimde "Şans" ve "Tesadüf" Kavramlarına Yer Yok mu?" başlıklı makalemizden başlamanızı öneririz.

Yazı dizisi içindeki ilerleyişinizi kaydetmek için veya kayıt olun.

EA Akademi Hakkında Bilgi Al

Matematiğin dili bizlere birçok insanın baktığı ama göremediği, Evren'in güzelliklerini ortaya seren bir araç sunmaktadır. Ancak antik filozofların ve matematikçilerin o dönemlerde asla anlayamayacağı ve bilmediği, ancak bizlerin bugün net olarak bildiğimiz ve anlayabildiğimiz, bir diğer dil daha var: yaşamın dili. Bu dilin de çoğu zaman farkına varmıyoruz, ancak emin olun, bu dil de matematik kadar baş döndürücü. Bu dilin adı, DNA.

DNA, ya da DeoksiriboNükleik Asit, bir biyopolimerdir ve fosfat-deoksiriboz omurgası üzerine inşa edilmiş, türden türe değişmekle birlikte insan için yaklaşık 3 milyar civarında nükleotit çiftini barındıran bir yapıdır. Nükleotitler, yaşamın alfabesini oluştururlar: Adenin, Timin, Guanin ve Sitozin (resmi olarak Cytosine olduğu için "C" harfi kullanılır). Bu 4 nükleotit, fosfat ve şeker molekülleriyle bir araya gelerek nükleobaz adını verdiğimiz yapıları oluşturur. İşte bu nükleobazlar, barındırdıkları nükleotitlerin baş harfiyle, A, T, G ve C olarak isimlendirilirler.

Bu Reklamı Kapat

İşte bu 4 harf, Türkçede kullandığımız 29 harf veya İngilizcenin 26 harfi gibi, "yaşamın dili" dediğimiz dilin harfleridir. Alfabe illa birçok harften oluşmak zorunda değildir. Nasıl ki 29 harfle tonlarca kitap yazabiliyorsak, 4 harfle de şimdiye kadar var olmuş istisnasız her canlının, istisnasız her geni ve özelliği yazılabilmiş ve kodlanabilmiştir. Şaşırtıcı değil mi? Hem öyle, hem de değil aslında... Çünkü bu dil, bizim dillerimize göre son derece ilkeldir. Ancak yine de, milyarlarca türün evrim sürecinde özelliklerinin kodlanabilmesi için yeterli olmuştur. Gelin sizle bu harflerle yazabileceğimiz bir cümleye bakalım:

ATGAAGTCGATCCTAGATGGCCTTGGAGACACCACCTTCCGTACCATCACCACAGACCTC…

Bu Reklamı Kapat

Okuduğunuz kitaplardaki veya bu satırlardaki cümlelere pek benzemiyor değil mi? Ancak unutmayın! Bu yeni ve ayrı bir dil, dolayısıyla eğer okumak istiyorsanız, önce nasıl okunacağını öğrenmelisiniz. Ancak okumayı öğrenmeden önce, yazmayı öğrenmeyi deneyebiliriz.

Bu cümle, elbette ki hücrelerimiz içerisinde kalem defter kullanılarak yazılmıyor. Evrimsel süreçte oluşan DNA'nın torunları, her seferinde bir miktar farklılaşarak, yüz binlerce nesil boyunca bu yapıyı "kopyalanma" dediğimiz bir mekanizma ile torunlarına aktarmayı başarabilmiş, başaramayanlar da elenmiştir. Canlıların her bir özelliğini belirleyen yapılar, genel olarak proteinlerdir. Ve proteinler, yaşamın diline göre oluştururlar. Tıpkı "100 şınav çek asker!" şeklinde gelen, Türkçe bir emir üzerine, askerin emri olduğu gibi uygulamasına benziyor bu... Ancak asker de bu emri uygularken hata yapabildiği gibi, genlerimiz de kopyalanma sırasında hatalar yapabiliyor ve bu, genetik çeşitliliğin ana kaynaklarından biri oluyor. Hatalar olmasaydı, canlılık bugün bu kadar karmaşık olmayacaktı. Tıpkı hayatta hatalar yapmasaydık, bu kadar başarılı ve donanımlı olamayacağımız gibi...

Emir-komuta zinciri
Emir-komuta zinciri
Wiktionary

Gerçekten de DNA'nın durumunu askeriyeye ya da hayata benzetmek mümkündür. DNA, yani canlılar da "hatalarından öğrenirler". Ancak bu öğrenme, birey bazında meydana gelmez, popülasyon bazında ve nesiller boyunca meydana gelir. Neden mi? Çünkü DNA'da yapılan hatalar sadece "öğretici" değil, "ölümcül" olabilir. Ölümcül olan değişimler elenir, böylece o değişimlerin yayılması mümkün olmaz. Tıpkı ölümcül bir hatayı tekrar yapmaktan kaçınmamız gibi... Elbette DNA'nın bir bilinci yoktur; dolayısıyla önceden yaptığı hataları tekrar etmekten kaçınmaya çalışamaz. Ancak geniş ölçekte bakacak olursak, ölümcül hatalar sürekli elendiği için, zaten DNA'sında o hatalar bulunanların yayılması mümkün olmaz. Öte yandan bazı hatalar oldukça faydalıdır, çünkü bireye değer katarlar. Evrimde de böyledir. DNA'nın aktarımı sırasında yapılan bazı hatalar, önceden o popülasyondaki hiçbir bireyin başaramadığı şeylerin başarılmasını sağlar. Örneğin çevrenin değişmesinden ötürü beyaz renkli olmak avantajlı hale gelmiş olabilir; ancak DNA bunu "bilemez" (çünkü bilinci yoktur). Bilecek olsa, zaten hataya gerek kalmazdı, doğrudan yapması gerekeni yapardı. Ancak bunu yapamaz. Dolayısıyla meydana gelen hatalardan biri eğer ki deri renginin beyaz olmasına neden oluyorsa, bu bireyler birden dikkate değer bir avantaj sağlayacak ve popülasyonda kolaylıkla çoğalacaktır. Böylece yaşam, hatalarından öğrenerek çeşitlenecektir.

Evrim Ağacı'ndan Mesaj

İşte yaşamın diline de bir emir-komuta zinciri gibi baktığımızda, yukarıda söz ettiğimiz cümlenin yazılabilmesi ve dolayısıyla belli bir işin yapılabilmesi ya da belli bir özelliğin oluşabilmesi için, öncelikle bir emir gelmelidir. İşte bu emir cümlesi, DNA'nın kendisindeki 3 milyar baz çiftinin bir kısmından okunur. Eğer ki yukarıdaki, "hücre bölünmesini başlatmayı sağlayan proteinlerin" koduysa, o zaman "Hücre bölünmesini başlat!" emri, DNA'dan okunabilmelidir. İşte o emir, DNA'da şu şekilde kodlanır:

TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAG…

Emrin verildiği diziyi ve emrin kendisini alt alta inceleyelim:

ATGAAGTCGATCCTAGATGGCCTTGGAGACACCACCTTCCGTACCATCACCACAGACCTC

TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAG…

Bu Reklamı Kapat

Burada, her bir nükleotitin karşısına, onun "eşi" gelmektedir. Bu eş, bir A için (hata olmadığı sürece) her zaman T; bir G için (hata olmadığı sürece) her zaman C'dir. Adım adım takip edecek olursanız, tüm sıralamanın doğru olduğunu göreceksiniz. Dolayısıyla DNA, az önce verdiğimiz cümle sayesinde "Hücre bölünmesini başlat!" emri verir ve RNA aracılığıyla (emri uşağa ileten bir aracı, ulak gibidir) bu emir ribozoma taşınır ve ribozomda, mümkün olduğunca hatasız bir şekilde emrin sonucunu sağlayacak proteinler üretilir. Dolayısıyla aslında mekanizma son derece basit, son derece sıradandır. Ancak moleküler düzeyde bu organizasyonu görmek, birçokları için abartılacak bir unsur haline gelmektedir. Ne var ki biyokimyanın içerisine girip, moleküllerin birbiriyle olan etkileşimleri incelendiğinde ve bu etkileşimlerin ne kadar spesifik ve ne kadar spontane olduğu anlaşıldığında, aslında zaten moleküllerin, uygun oldukları tepkimelere girmekten başka pek de çareleri olmadıkları görülecektir. Dolayısıyla her şey, moleküllerin sayıca ve türce fazla olmasında bitmektedir. Bu fazlalık sağlandığında (ki evrenimizdeki moleküler ve atomik çeşitlilik bunu mümkün kılmaktadır), bir "şehir gibi" karmaşık ağların hücre içerisinde görülmesi o kadar da şaşırtıcı olmaktan çıkmaktadır. Elbette heyecan verici ve etkileyici, ancak "inanılmaz" değil.

Şimdi... Emir-komuta zincirini anladık sanıyoruz ki: emir DNA'dan gelir, aracılardan geçer ve bir protein, yani bir iş/ürün/sonuç olarak ortaya çıkar. Öyleyse, şimdi bu dili nasıl okuduğumuza veya hücrelerimizde nasıl okunduğuna geçelim:

Nasıl ki, her cümleyi harflere ve sözcüklere bölerek analiz edebiliyorsak, yaşamın dili de harflere ve sözcüklere bölünebilir. Harflere bölündüğünde ne elde ettiğimizi artık biliyoruz: A, T, C ve G. Ancak sözcüklere bölme işi, dilin aslında ne kadar ilkel olduğunu ve niye böyle nitelediğimizi anlamanızı sağlayacaktır: yaşamın dili, her zaman 3 harflidir. Yani, yaşamın dilindeki sözcüklere bakacak olursanız, asla 1-2 harfli ya da 3'ten fazla harfli bir sözcük bulamazsınız. Bu dildeki sözcükler, her zaman 3 harflidir. Yani nasıl ki "Hücre bölünmesini başlat!" emrini, Türkçe olarak analiz ettiğimizde 5, 6 ve hatta 11 harfli sözcükleri görebiliyorsak, yukarıda verdiğimiz genetik emir cümlesini ya da proteini (emrin sonucunu) okuyacak olursak, sadece 3 harfli sözcükler kurabiliriz. Şöyle:

ATG AAG TCG ATC CTA GAT GGC CTT GCA GAC ACC ACC TTC CGT ACC ATC ACC ACA GAC CTC…

Bu Reklamı Kapat

Daha anlaşılır, değil mi? Eh, "Hücrebölünmesinibaşlat!" yazmaktansa, "Hücre bölünmesini başlat!" yazmakta olduğu gibi... Ancak biz 29 harf ve neredeyse sınırsız sözcük uzunluğumuzla on binlerce kelime türetebiliriz. Ne var ki yaşam, bu 4 harfle ve sadece 3 harf uzunluğundaki sözcüklerle sadece 64 tane sözcük üretebilir. Ancak unutmayın! Bu başka bir dil! Türkçe ya da diğer insan dillerinde sözcüklerin nasıl yan yana geldikleri önemlidir ve her dizilim, anlamlı cümleler oluşturmaz. Örneğin: "Hücre koşuşturmasını uçur!" cümlesinin hiçbir anlamı yokken, "Hücre bölünmesini başlat!" anlamlı bir cümledir. Ne var ki yaşamın dilinde tam olarak böyle değildir: bu 64 sözcük, sınırsız sırada ve sınırsız uzunlukta bir araya gelerek, her seferinde anlamlı, en azından bir ürün verebilecek ifadeler oluşturabilirler. İşte dilin bu özelliği sebebiyle yaşam bu kadar çeşitli olabilmektedir. Unutmayınız ki burada Türkçe analojisi kullanıyor olsak da, bahsettiğimiz diller yapıca ve nitelikçe birbirinden son derece farklı olgulardır. Tabii iki konu arasındaki benzerlikler de aşikar... Bir diğer örnek:

Bu dilin içerisinde, "cümle başlangıcı" (aynı "büyük harf" gibi) ve "cümle sonu" (nokta gibi) sözcükler vardır. Örneğin GTC sözcüğü, "Buradan okunmaya başlayacak." anlamına gelebilirken, TAG sözcüğü "Burada okumayı sonlandır." anlamına gelmektedir. Bunu ilkel bir kabilenin tek ses ile çok şey anlatmasına benzetebilirsiniz. Tabii yaşamın dilinde "ses" ile işimiz yok...

İşte bu şekilde, basit bir başlangıçtan, bu kadar güzel ve karmaşık bir yaşam ortaya çıkabilmektedir. Adeta olay yerine sonradan ulaşan detektifler gibi, genleri analiz ettiğimizde, yaşamın evrimsel süreçte nasıl değişerek, nasıl kademeli olarak günümüze ulaştığını anlamamız son derece kolay olmaktadır. Örneğin, gelin bir güve, bir meyve sineği ve bir deniz kabuklusu gibi apayrı canlıların, genetik dizilimlerinin aynı bölgesinden alınan cümlelere bir bakalım:

Güve:

Bu Reklamı Kapat

Agora Bilim Pazarı
Medikal Embriyoloji (Langman)
  • Boyut: 18 X 25
  • Sayfa Sayısı: 400
  • ISBN No: 9786053557876
Devamını Göster
₺265.00
Medikal Embriyoloji (Langman)

GTC GGG CGC GGT CAG TAC TTG GAT GGG TGA CCA CCT GGG AAC ACC GCG TGC CGT TGG…

Güve
Güve
Wikimedia Commons

Meyve Sineği:

GTC GGG CGC GGT TAG TAC TTA GAT GGG GGA CCG CTT GGG AAC ACC GCG TGT TGT TGG…

Meyve Sineği
Meyve Sineği
Wikimedia

Deniz Kabuklusu:

GTC GGG CCC GGT CAG TAC TTG GAT GGG TGA CCG CCT GGG AAC ACC GGG TGC TGT TGG…

Deniz Kabuklusu
Deniz Kabuklusu
Wikipedia

Durmayın, kontrol edin. Arada 1-2 farklılık göreceksiniz. Bu tıpkı, bir kitabın fotokopi ile değil de, el yazması olarak binlerce, milyonlarca defa, olabildiğince özenli ama insani hata sınırlarıyla birlikte kopyalanması sonucunda, birkaç yüz harfte 1-2 defa yapılan hatalara benzemektedir. Ancak bu ufak hatalar, bir araya gelerek ve birikerek, daha da önemlisi bu değişimlerden kaynaklı özellik farklılıklar, içinde bulunulan doğa koşullarına göre seçilerek, günümüze kadar ulaşabilmekte ve türün ayırt edici özelliklerinin oluşmasında ve yeni türlerin evrimleşmesinde görev almaktadırlar.

Burada sorabilirsiniz: "İyi de bir kitaptaki hatalar birikerek neredeyse asla anlamlı bir sözcük oluşturamazlar; bu harfler hatalı kopyalanarak nasıl işe yarar canlılar ve özellikler var edebiliyor?" İşte bunun sebebi bizim konuşma dilimiz ile genlerin dilinin aynı şekilde çalışmamasındandır. Bizim dilimizde "araba" sözcüğünü "hraka" diye yazdığınızda bir anlam ifade etmese de, DNA dilinde harflerin "hatalı" sıralaması da anlamlı sonuçlar yaratabilir. Bunun sebebi kimyasal tepkimelerin kaotik (stokastik) doğasıdır. Ufak değişimler sonucu tamamen değiştirmek zorunda değildir; sonucun gözle tespit bile edilemeyecek miktarda değiştirebilir ve bu da canlılar arasındaki farklılıkları yaratır: boy uzunluğundan tutun da deri rengine kadar. Fakat bunlar evrim değildir, bunlar çeşitliliktir. Bu ufak değişimler, o anda bulunulan çevrenin etkisi altında "seçilir" veya "elenir". Seçilenler hayatta kalır ve ürerler, bu sayede kendilerindeki "hatalı" gen kopyalarını (dillerini) gelecek nesillere aktarırlar. Böylece popülasyon içerisindeki bu hatalar birikir. Ancak bunlara artık "hata" demek doğru değildir, çünkü çevre karşısında fayda sağlamıştır. Bunu tıpkı dilimizde hatalı söylenen sözcüklerin "tutmasından" ötürü yer etmesine benzetebilirsiniz aslında. Örneğin eskiden "kan kardeş" olarak bilinen kalıp, günümüzde "kanka", "panpa", "pampa" gibi birçok sözcükle karşılanabilmektedir. Bunlar dışarıdan bir müdahale ile değişmemiştir, dilin normal gelişimi sırasında değişmiş ve adaptif oldukları için dilde yer etmiştir.

Yaşamın dili tüm canlılarda ortak olsa da, yukarıdaki üç canlının fotoğraflarına bakacak olursanız, tamamen farklı olduklarını göreceksiniz. Farklı görünürler, farklı yaşarlar, farklı davranırlar, farklı eşsiz nitelikleri vardır... Ancak özlerinde, genetik kodlarına baktığımızda, evrimsel sürecin imzasını parlak bir şekilde görürüz. Esasında Dünya tarihinde ve bugününde ele alacağınız her iki tür, her iki birey, evrimsel süreçte birbiriyle mutlaka akrabadır. Ancak bu akrabalık 1. derece kadar yakın olabileceği gibi, yüz bininci derece kadar uzak da olabilir. Baş döndürücü olansa, tıpkı kopyalanan bir kitaptaki hataları takip ederek tarih içerisindeki farklı kopyalara ulaşabilmemiz gibi, türlerin genlerindeki hataları takip ederek, ortak atalara ve akrabalık ilişkilerine ulaşabiliyor olmamızdır.

Okundu Olarak İşaretle

Bu içeriğimizle ilgili bir sorunuz mu var? Buraya tıklayarak sorabilirsiniz.

İlginizi Çekebilecek Sorular
Soru & Cevap Platformuna Git
Bu İçerik Size Ne Hissettirdi?
  • Tebrikler! 14
  • Muhteşem! 9
  • Bilim Budur! 8
  • Mmm... Çok sapyoseksüel! 6
  • Merak Uyandırıcı! 5
  • İnanılmaz 4
  • Güldürdü 0
  • Umut Verici! 0
  • Üzücü! 0
  • Grrr... *@$# 0
  • İğrenç! 0
  • Korkutucu! 0
Kaynaklar ve İleri Okuma
  • ORNL. İnsan Genom Projesi. (22 Şubat 2019). Alındığı Tarih: 22 Şubat 2019. Alındığı Yer: ORNL | Arşiv Bağlantısı
Evrim Ağacı Akademi: Evrimi Anlamak Yazı Dizisi

Bu yazı, Evrimi Anlamak yazı dizisinin 7. yazısıdır. Bu yazı dizisini okumaya, serinin 1. yazısı olan ""Tesadüf" Geliyor, Kaçın! Bilimde "Şans" ve "Tesadüf" Kavramlarına Yer Yok mu?" başlıklı makalemizden başlamanızı öneririz.

Yazı dizisi içindeki ilerleyişinizi kaydetmek için veya kayıt olun.

EA Akademi Hakkında Bilgi Al
Bu Reklamı Kapat

Evrim Ağacı'na her ay sadece 1 kahve ısmarlayarak destek olmak ister misiniz?

Şu iki siteden birini kullanarak şimdi destek olabilirsiniz:

kreosus.com/evrimagaci | patreon.com/evrimagaci

Çıktı Bilgisi: Bu sayfa, Evrim Ağacı yazdırma aracı kullanılarak 29/06/2022 09:44:37 tarihinde oluşturulmuştur. Evrim Ağacı'ndaki içeriklerin tamamı, birden fazla editör tarafından, durmaksızın elden geçirilmekte, güncellenmekte ve geliştirilmektedir. Dolayısıyla bu çıktının alındığı tarihten sonra yapılan güncellemeleri görmek ve bu içeriğin en güncel halini okumak için lütfen şu adrese gidiniz: https://evrimagaci.org/s/390

İçerik Kullanım İzinleri: Evrim Ağacı'ndaki yazılı içerikler orijinallerine hiçbir şekilde dokunulmadığı müddetçe izin alınmaksızın paylaşılabilir, kopyalanabilir, yapıştırılabilir, çoğaltılabilir, basılabilir, dağıtılabilir, yayılabilir, alıntılanabilir. Ancak bu içeriklerin hiçbiri izin alınmaksızın değiştirilemez ve değiştirilmiş halleri Evrim Ağacı'na aitmiş gibi sunulamaz. Benzer şekilde, içeriklerin hiçbiri, söz konusu içeriğin açıkça belirtilmiş yazarlarından ve Evrim Ağacı'ndan başkasına aitmiş gibi sunulamaz. Bu sayfa izin alınmaksızın düzenlenemez, Evrim Ağacı logosu, yazar/editör bilgileri ve içeriğin diğer kısımları izin alınmaksızın değiştirilemez veya kaldırılamaz.

Bu Reklamı Kapat
Size Özel (Beta)
İçerikler
Sosyal
Gönderiler
Vejetaryen
Önlem
Genel Halk
Kütleçekimi
Oyun Teorisi
İnternet
Hayvan
Biyoloji
Özel Görelilik
Virüsler
Yemek
Rna
Enzim
Kimyasal Element
Genom
Antik
Nöron Hücresi
Genel Görelilik
Sosyal Medya
Fizik
Ağaç
Epigenetik
Karbonhidrat
Boyut
Malzeme
Aklımdan Geçen
Komünite Seç
Aklımdan Geçen
Fark Ettim ki...
Bugün Öğrendim ki...
İşe Yarar İpucu
Bilim Haberleri
Hikaye Fikri
Başlık
Kafana takılan neler var?
Bağlantı
Gönder
Ekle
Soru Sor
Daha Fazla İçerik Göster
Evrim Ağacı'na Destek Ol
Evrim Ağacı'nın %100 okur destekli bir bilim platformu olduğunu biliyor muydunuz? Evrim Ağacı'nın maddi destekçileri arasına katılarak Türkiye'de bilimin yayılmasına güç katmak için hemen buraya tıklayın.
Popüler Yazılar
30 gün
90 gün
1 yıl
EA Akademi
Evrim Ağacı Akademi (ya da kısaca EA Akademi), 2010 yılından beri ürettiğimiz makalelerden oluşan ve kendi kendinizi bilimin çeşitli dallarında eğitebileceğiniz bir çevirim içi eğitim girişimi! Evrim Ağacı Akademi'yi buraya tıklayarak görebilirsiniz. Daha fazla bilgi için buraya tıklayın.
Etkinlik & İlan
Bilim ile ilgili bir etkinlik mi düzenliyorsunuz? Yoksa bilim insanlarını veya bilimseverleri ilgilendiren bir iş, staj, çalıştay, makale çağrısı vb. bir duyurunuz mu var? Etkinlik & İlan Platformumuzda paylaşın, milyonlarca bilimsevere ulaşsın.
Podcast
Evrim Ağacı'nın birçok içeriğinin profesyonel ses sanatçıları tarafından seslendirildiğini biliyor muydunuz? Bunların hepsini Podcast Platformumuzda dinleyebilirsiniz. Ayrıca Spotify, iTunes, Google Podcast ve YouTube bağlantılarını da bir arada bulabilirsiniz.
Yazı Geçmişi
Okuma Geçmişi
Notlarım
İlerleme Durumunu Güncelle
Okudum
Sonra Oku
Not Ekle
Kaldığım Yeri İşaretle
Göz Attım

Evrim Ağacı tarafından otomatik olarak takip edilen işlemleri istediğin zaman durdurabilirsin.
[Site ayalarına git...]

Filtrele
Listele
Bu yazıdaki hareketlerin
Devamını Göster
Filtrele
Listele
Tüm Okuma Geçmişin
Devamını Göster
0/10000

Göster

Şifremi unuttum Üyelik Aktivasyonu

Göster

Şifrenizi mi unuttunuz? Lütfen e-posta adresinizi giriniz. E-posta adresinize şifrenizi sıfırlamak için bir bağlantı gönderilecektir.

Geri dön

Eğer aktivasyon kodunu almadıysanız lütfen e-posta adresinizi giriniz. Üyeliğinizi aktive etmek için e-posta adresinize bir bağlantı gönderilecektir.

Geri dön

Close
Geri Bildirim Gönder
Paylaş
Soru Sor
Görsel Ekle
Kurallar
Platform Kuralları
Bu platform, aklınıza takılan soruları sorabilmeniz ve diğerlerinin sorularını yanıtlayabilmeniz içindir. Yapacağınız paylaşımlar Evrim Ağacı'nın kurallarına tabidir. Ayrıca bu platformun ek kurallarına da uymanız gerekmektedir.
1
Gerçekten soru sorun, imâdan ve yüklü sorulardan kaçının.
Sorularınızın amacı nesnel olarak gerçeği öğrenmek veya fikir almak olmalıdır. Şahsi kanaatinizle ilgili mesaj vermek için kullanmayın; yüklü soru sormayın.
2
Bilim kimliğinizi kullanın.
Evrim Ağacı bir bilim platformudur. Dolayısıyla sorular ve cevaplar, bilimsel perspektifi yansıtmalıdır. Geçerli bilimsel kaynaklarla doğrulanamayan bilgiler veya reklamlar silinebilir.
3
Düzgün ve insanca iletişim kurun.
Gerilim, tersleme, tahrik, taciz, alay, dedikodu, trollük, vurdumduymazlık, duyarsızlık, ırkçılık, bağnazlık, nefret söylemi, azınlıklara saldırı, fanatizm, holiganlık, sloganlar yasaktır.
4
Sahtebilimi desteklemek yasaktır.
Sahtebilim kategorisi altında konuyla ilgili sorular sorabilirsiniz; ancak bilimsel geçerliliği bulunmayan sahtebilim konularını destekleyen sorular veya cevaplar paylaşmayın.
5
Türkçeyi düzgün kullanın.
Şair olmanızı beklemiyoruz; ancak yazdığınız içeriğin anlaşılır olması ve temel düzeyde yazım ve dil bilgisi kurallarına uyması gerekmektedir.
Reklamsız Deneyim

Evrim Ağacı'nda reklamları 2 şekilde kapatabilirsiniz:

  1. Ücretsiz üye girişi yapmak: Sitedeki reklamların %50 kadarını kapatmak için ücretsiz bir Evrim Ağacı üyeliği açmanız ve sitemizi/uygulamamızı kullanmanız yeterli!

  2. Maddi destekçilerimiz arasına katılmak: Evrim Ağacı'nın çalışmalarına Kreosus, Patreon veya YouTube üzerinden maddi destekte bulunarak hem Türkiye'de bilim anlatıcılığının gelişmesine katkı sağlayabilirsiniz, hem de site ve uygulamamızı reklamsız olarak deneyimleyebilirsiniz. Reklamsız deneyim, sitemizin/uygulamamızın çeşitli kısımlarda gösterilen Google reklamlarını ve destek çağrılarını görmediğiniz, %100 reklamsız ve çok daha temiz bir site deneyimi sunmaktadır.

Kreosus

Kreosus'ta her 10₺'lik destek, 1 aylık reklamsız deneyime karşılık geliyor. Bu sayede, tek seferlik destekçilerimiz de, aylık destekçilerimiz de toplam destekleriyle doğru orantılı bir süre boyunca reklamsız deneyim elde edebiliyorlar.

Kreosus destekçilerimizin reklamsız deneyimi, destek olmaya başladıkları anda devreye girmektedir ve ek bir işleme gerek yoktur.

Patreon

Patreon destekçilerimiz, destek miktarından bağımsız olarak, Evrim Ağacı'na destek oldukları süre boyunca reklamsız deneyime erişmeyi sürdürebiliyorlar.

Patreon destekçilerimizin Patreon ile ilişkili e-posta hesapları, Evrim Ağacı'ndaki üyelik e-postaları ile birebir aynı olmalıdır. Patreon destekçilerimizin reklamsız deneyiminin devreye girmesi 24 saat alabilmektedir.

YouTube

YouTube destekçilerimizin hepsi otomatik olarak reklamsız deneyime şimdilik erişemiyorlar ve şu anda, YouTube üzerinden her destek seviyesine reklamsız deneyim ayrıcalığını sunamamaktayız. YouTube Destek Sistemi üzerinde sunulan farklı seviyelerin açıklamalarını okuyarak, hangi ayrıcalıklara erişebileceğinizi öğrenebilirsiniz.

Eğer seçtiğiniz seviye reklamsız deneyim ayrıcalığı sunuyorsa, destek olduktan sonra YouTube tarafından gösterilecek olan bağlantıdaki formu doldurarak reklamsız deneyime erişebilirsiniz. YouTube destekçilerimizin reklamsız deneyiminin devreye girmesi, formu doldurduktan sonra 24-72 saat alabilmektedir.

Diğer Platformlar

Bu 3 platform haricinde destek olan destekçilerimize ne yazık ki reklamsız deneyim ayrıcalığını sunamamaktayız. Destekleriniz sayesinde sistemlerimizi geliştirmeyi sürdürüyoruz ve umuyoruz bu ayrıcalıkları zamanla genişletebileceğiz.

Giriş yapmayı unutmayın!

Reklamsız deneyim için, maddi desteğiniz ile ilişkilendirilmiş olan Evrim Ağacı hesabınıza yapmanız gerekmektedir. Giriş yapmadığınız takdirde reklamları görmeye devam edeceksinizdir.

Destek Ol

Devamını Oku
Evrim Ağacı Uygulamasını
İndir
Chromium Tabanlı Mobil Tarayıcılar (Chrome, Edge, Brave vb.)
İlk birkaç girişinizde zaten tarayıcınız size uygulamamızı indirmeyi önerecek. Önerideki tuşa tıklayarak uygulamamızı kurabilirsiniz. Bu öneriyi, yukarıdaki videoda görebilirsiniz. Eğer bu öneri artık gözükmüyorsa, Ayarlar/Seçenekler (⋮) ikonuna tıklayıp, Uygulamayı Yükle seçeneğini kullanabilirsiniz.
Chromium Tabanlı Masaüstü Tarayıcılar (Chrome, Edge, Brave vb.)
Yeni uygulamamızı kurmak için tarayıcı çubuğundaki kurulum tuşuna tıklayın. "Yükle" (Install) tuşuna basarak kurulumu tamamlayın. Dilerseniz, Evrim Ağacı İleri Web Uygulaması'nı görev çubuğunuza sabitleyin. Uygulama logosuna sağ tıklayıp, "Görev Çubuğuna Sabitle" seçeneğine tıklayabilirsiniz. Eğer bu seçenek gözükmüyorsa, tarayıcının Ayarlar/Seçenekler (⋮) ikonuna tıklayıp, Uygulamayı Yükle seçeneğini kullanabilirsiniz.
Safari Mobil Uygulama
Sırasıyla Paylaş -> Ana Ekrana Ekle -> Ekle tuşlarına basarak yeni mobil uygulamamızı kurabilirsiniz. Bu basamakları görmek için yukarıdaki videoyu izleyebilirsiniz.

Daha fazla bilgi almak için tıklayın

Önizleme
Görseli Kaydet
Sıfırla
Vazgeç
Ara
Raporla

Raporlama sisteminin amacı, platformu uygunsuz biçimde kullananların önüne geçmektir. Lütfen bir içeriği, sadece düşük kaliteli olduğunu veya soruya cevap olmadığını düşündüğünüz raporlamayınız; bu raporlar kabul edilmeyecektir. Bunun yerine daha kaliteli cevapları kendiniz girmeye çalışın veya diğer kullanıcıları oylama, teşekkür ve kabul edilen cevap araçları ile daha kaliteli cevaplara teşvik edin. Kalitesiz bulduğunuz içerikleri eleyebileceğiniz, kalitelileri daha ön plana çıkarabileceğiniz yeni araçlar geliştirmekteyiz.

Alıntı Ekle
Eser Ekle
Kurallar
Komünite Kuralları
Bu komünite, fark edildiğinde ufku genişleten tespitler içindir. Yapacağınız paylaşımlar Evrim Ağacı'nın kurallarına tabidir. Ayrıca bu komünitenin ek kurallarına da uymanız gerekmektedir.
1
Formu olabildiğince eksiksiz doldurun.
Girdiğiniz sözün/alıntının kaynağı ne kadar açıksa o kadar iyi. Açıklama kısmına kitabın sayfa sayısını veya filmin saat/dakika/saniye bilgisini girebilirsiniz.
2
Anonimden kaçının.
Bazı sözler/alıntılar anonim olabilir. Fakat sözün anonimliğini doğrulamaksızın, bilmediğiniz her söze/alıntıya anonim yazmayın. Bu tür girdiler silinebilir.
3
Kaynağı araştırın ve sorgulayın.
Sayısız söz/alıntı, gerçekte o sözü hiçbir zaman söylememiş/yazmamış kişilere, hatalı bir şekilde atfediliyor. Paylaşımınızın site geneline yayılabilmesi için kaliteli kaynaklar kullanın ve kaynaklarınızı sorgulayın.
4
Ofansif ve entelektüel düşünceden uzak sözler yasaktır.
Gerilim, tersleme, tahrik, taciz, alay, dedikodu, trollük, vurdumduymazlık, duyarsızlık, ırkçılık, bağnazlık, nefret söylemi, azınlıklara saldırı, fanatizm, holiganlık, sloganlar yasaktır.
5
Sözlerinizi tırnak (") içine almayın.
Sistemimiz formatı otomatik olarak ayarlayacaktır.
Gönder
Tavsiye Et
Aşağıdaki kutuya, [ESER ADI] isimli [KİTABI/FİLMİ] neden tavsiye ettiğini girebilirsin. Ne kadar detaylı ve kapsamlı bir analiz yaparsan, bu eseri [OKUMAK/İZLEMEK] isteyenleri o kadar doğru ve fazla bilgilendirmiş olacaksın. Tavsiyenin sadece negatif içerikte olamayacağını, eğer bu sistemi kullanıyorsan tavsiye ettiğin içeriğin pozitif taraflarından bahsetmek zorunda olduğunu lütfen unutma. Yapıcı eleştiri hakkında daha fazla bilgi almak için burayı okuyabilirsin.
Kurallar
Platform Kuralları
Bu platform; okuduğunuz kitaplara, izlediğiniz filmlere/belgesellere veya takip ettiğiniz YouTube kanallarına yönelik tavsiylerinizi ve/veya yapıcı eleştirel fikirlerinizi girebilmeniz içindir. Tavsiye etmek istediğiniz eseri bulamazsanız, buradan yeni bir kayıt oluşturabilirsiniz. Yapacağınız paylaşımlar Evrim Ağacı'nın kurallarına tabidir. Ayrıca bu platformun ek kurallarına da uymanız gerekmektedir.
1
Önceliğimiz pozitif tavsiyelerdir.
Bu platformu, beğenmediğiniz eserleri yermek için değil, beğendiğiniz eserleri başkalarına tanıtmak için kullanmaya öncelik veriniz. Sadece negatif girdileri olduğu tespit edilenler platformdan geçici veya kalıcı olarak engellenebilirler.
2
Tavsiyenizin içeriği sadece negatif olamaz.
Tavsiye yazdığınız eserleri olabildiğince objektif bir gözlükle anlatmanız beklenmektedir. Dolayısıyla bir eseri beğenmediyseniz bile, tavsiyenizde eserin pozitif taraflarından da bahsetmeniz gerekmektedir.
3
Negatif eleştiriler yapıcı olmak zorundadır.
Eğer tavsiyenizin ana tonu negatif olacaksa, tüm eleştirileriniz yapıcı nitelikte olmak zorundadır. Yapıcı eleştiri kurallarını buradan öğrenebilirsiniz. Yapıcı bir tarafı olmayan veya tamamen yıkıcı içerikte olan eleştiriler silinebilir ve yazarlar geçici veya kalıcı olarak engellenebilirler.
4
Düzgün ve insanca iletişim kurun.
Gerilim, tersleme, tahrik, taciz, alay, dedikodu, trollük, vurdumduymazlık, duyarsızlık, ırkçılık, bağnazlık, nefret söylemi, azınlıklara saldırı, fanatizm, holiganlık, sloganlar yasaktır.
5
Türkçeyi düzgün kullanın.
Şair olmanızı beklemiyoruz; ancak yazdığınız içeriğin anlaşılır olması ve temel düzeyde yazım ve dil bilgisi kurallarına uyması gerekmektedir.
Eser Ara
Aradığınız eseri bulamadıysanız buraya tıklayarak ekleyebilirsiniz.