Paylaşım Yap
Tüm Reklamları Kapat

DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!

DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin! Big Think
10 dakika
14,277
Evrim Ağacı Akademi: Evrimi Anlamak Yazı Dizisi

Bu yazı, Evrimi Anlamak yazı dizisinin 7. yazısıdır. Bu yazı dizisini okumaya, serinin 1. yazısı olan ""Tesadüf" Geliyor, Kaçın! Bilimde "Şans" ve "Tesadüf" Kavramlarına Yer Yok mu?" başlıklı makalemizden başlamanızı öneririz.

Yazı dizisi içindeki ilerleyişinizi kaydetmek için veya kayıt olun.

EA Akademi Hakkında Bilgi Al
Tüm Reklamları Kapat

Matematiğin dili bizlere birçok insanın baktığı ama göremediği, Evren'in güzelliklerini ortaya seren bir araç sunmaktadır. Ancak antik filozofların ve matematikçilerin o dönemlerde asla anlayamayacağı ve bilmediği, ancak bizlerin bugün net olarak bildiğimiz ve anlayabildiğimiz, bir diğer dil daha var: yaşamın dili. Bu dilin de çoğu zaman farkına varmıyoruz, ancak emin olun, bu dil de matematik kadar baş döndürücü. Bu dilin adı, DNA.

DNA, ya da DeoksiriboNükleik Asit, bir biyopolimerdir ve fosfat-deoksiriboz omurgası üzerine inşa edilmiş, türden türe değişmekle birlikte insan için yaklaşık 3 milyar civarında nükleotit çiftini barındıran bir yapıdır. Nükleotitler, yaşamın alfabesini oluştururlar: Adenin, Timin, Guanin ve Sitozin (resmi olarak Cytosine olduğu için "C" harfi kullanılır). Bu 4 nükleotit, fosfat ve şeker molekülleriyle bir araya gelerek nükleobaz adını verdiğimiz yapıları oluşturur. İşte bu nükleobazlar, barındırdıkları nükleotitlerin baş harfiyle, A, T, G ve C olarak isimlendirilirler.

İşte bu 4 harf, Türkçede kullandığımız 29 harf veya İngilizcenin 26 harfi gibi, "yaşamın dili" dediğimiz dilin harfleridir. Alfabe illa birçok harften oluşmak zorunda değildir. Nasıl ki 29 harfle tonlarca kitap yazabiliyorsak, 4 harfle de şimdiye kadar var olmuş istisnasız her canlının, istisnasız her geni ve özelliği yazılabilmiş ve kodlanabilmiştir. Şaşırtıcı değil mi? Hem öyle, hem de değil aslında... Çünkü bu dil, bizim dillerimize göre son derece ilkeldir. Ancak yine de, milyarlarca türün evrim sürecinde özelliklerinin kodlanabilmesi için yeterli olmuştur. Gelin sizle bu harflerle yazabileceğimiz bir cümleye bakalım:

Tüm Reklamları Kapat

ATGAAGTCGATCCTAGATGGCCTTGGAGACACCACCTTCCGTACCATCACCACAGACCTC…

Okuduğunuz kitaplardaki veya bu satırlardaki cümlelere pek benzemiyor değil mi? Ancak unutmayın! Bu yeni ve ayrı bir dil, dolayısıyla eğer okumak istiyorsanız, önce nasıl okunacağını öğrenmelisiniz. Ancak okumayı öğrenmeden önce, yazmayı öğrenmeyi deneyebiliriz.

Bu cümle, elbette ki hücrelerimiz içerisinde kalem defter kullanılarak yazılmıyor. Evrimsel süreçte oluşan DNA'nın torunları, her seferinde bir miktar farklılaşarak, yüz binlerce nesil boyunca bu yapıyı "kopyalanma" dediğimiz bir mekanizma ile torunlarına aktarmayı başarabilmiş, başaramayanlar da elenmiştir. Canlıların her bir özelliğini belirleyen yapılar, genel olarak proteinlerdir. Ve proteinler, yaşamın diline göre oluştururlar. Tıpkı "100 şınav çek asker!" şeklinde gelen, Türkçe bir emir üzerine, askerin emri olduğu gibi uygulamasına benziyor bu... Ancak asker de bu emri uygularken hata yapabildiği gibi, genlerimiz de kopyalanma sırasında hatalar yapabiliyor ve bu, genetik çeşitliliğin ana kaynaklarından biri oluyor. Hatalar olmasaydı, canlılık bugün bu kadar karmaşık olmayacaktı. Tıpkı hayatta hatalar yapmasaydık, bu kadar başarılı ve donanımlı olamayacağımız gibi...

Emir-komuta zinciri
Emir-komuta zinciri
Wiktionary

Gerçekten de DNA'nın durumunu askeriyeye ya da hayata benzetmek mümkündür. DNA, yani canlılar da "hatalarından öğrenirler". Ancak bu öğrenme, birey bazında meydana gelmez, popülasyon bazında ve nesiller boyunca meydana gelir. Neden mi? Çünkü DNA'da yapılan hatalar sadece "öğretici" değil, "ölümcül" olabilir. Ölümcül olan değişimler elenir, böylece o değişimlerin yayılması mümkün olmaz. Tıpkı ölümcül bir hatayı tekrar yapmaktan kaçınmamız gibi... Elbette DNA'nın bir bilinci yoktur; dolayısıyla önceden yaptığı hataları tekrar etmekten kaçınmaya çalışamaz. Ancak geniş ölçekte bakacak olursak, ölümcül hatalar sürekli elendiği için, zaten DNA'sında o hatalar bulunanların yayılması mümkün olmaz. Öte yandan bazı hatalar oldukça faydalıdır, çünkü bireye değer katarlar. Evrimde de böyledir. DNA'nın aktarımı sırasında yapılan bazı hatalar, önceden o popülasyondaki hiçbir bireyin başaramadığı şeylerin başarılmasını sağlar. Örneğin çevrenin değişmesinden ötürü beyaz renkli olmak avantajlı hale gelmiş olabilir; ancak DNA bunu "bilemez" (çünkü bilinci yoktur). Bilecek olsa, zaten hataya gerek kalmazdı, doğrudan yapması gerekeni yapardı. Ancak bunu yapamaz. Dolayısıyla meydana gelen hatalardan biri eğer ki deri renginin beyaz olmasına neden oluyorsa, bu bireyler birden dikkate değer bir avantaj sağlayacak ve popülasyonda kolaylıkla çoğalacaktır. Böylece yaşam, hatalarından öğrenerek çeşitlenecektir.

Tüm Reklamları Kapat

İşte yaşamın diline de bir emir-komuta zinciri gibi baktığımızda, yukarıda söz ettiğimiz cümlenin yazılabilmesi ve dolayısıyla belli bir işin yapılabilmesi ya da belli bir özelliğin oluşabilmesi için, öncelikle bir emir gelmelidir. İşte bu emir cümlesi, DNA'nın kendisindeki 3 milyar baz çiftinin bir kısmından okunur. Eğer ki yukarıdaki, "hücre bölünmesini başlatmayı sağlayan proteinlerin" koduysa, o zaman "Hücre bölünmesini başlat!" emri, DNA'dan okunabilmelidir. İşte o emir, DNA'da şu şekilde kodlanır:

TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAG…

Emrin verildiği diziyi ve emrin kendisini alt alta inceleyelim:

ATGAAGTCGATCCTAGATGGCCTTGGAGACACCACCTTCCGTACCATCACCACAGACCTC

Evrim Ağacı'ndan Mesaj

TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAG…

Burada, her bir nükleotitin karşısına, onun "eşi" gelmektedir. Bu eş, bir A için (hata olmadığı sürece) her zaman T; bir G için (hata olmadığı sürece) her zaman C'dir. Adım adım takip edecek olursanız, tüm sıralamanın doğru olduğunu göreceksiniz. Dolayısıyla DNA, az önce verdiğimiz cümle sayesinde "Hücre bölünmesini başlat!" emri verir ve RNA aracılığıyla (emri uşağa ileten bir aracı, ulak gibidir) bu emir ribozoma taşınır ve ribozomda, mümkün olduğunca hatasız bir şekilde emrin sonucunu sağlayacak proteinler üretilir. Dolayısıyla aslında mekanizma son derece basit, son derece sıradandır. Ancak moleküler düzeyde bu organizasyonu görmek, birçokları için abartılacak bir unsur haline gelmektedir. Ne var ki biyokimyanın içerisine girip, moleküllerin birbiriyle olan etkileşimleri incelendiğinde ve bu etkileşimlerin ne kadar spesifik ve ne kadar spontane olduğu anlaşıldığında, aslında zaten moleküllerin, uygun oldukları tepkimelere girmekten başka pek de çareleri olmadıkları görülecektir. Dolayısıyla her şey, moleküllerin sayıca ve türce fazla olmasında bitmektedir. Bu fazlalık sağlandığında (ki evrenimizdeki moleküler ve atomik çeşitlilik bunu mümkün kılmaktadır), bir "şehir gibi" karmaşık ağların hücre içerisinde görülmesi o kadar da şaşırtıcı olmaktan çıkmaktadır. Elbette heyecan verici ve etkileyici, ancak "inanılmaz" değil.

Şimdi... Emir-komuta zincirini anladık sanıyoruz ki: emir DNA'dan gelir, aracılardan geçer ve bir protein, yani bir iş/ürün/sonuç olarak ortaya çıkar. Öyleyse, şimdi bu dili nasıl okuduğumuza veya hücrelerimizde nasıl okunduğuna geçelim:

Nasıl ki, her cümleyi harflere ve sözcüklere bölerek analiz edebiliyorsak, yaşamın dili de harflere ve sözcüklere bölünebilir. Harflere bölündüğünde ne elde ettiğimizi artık biliyoruz: A, T, C ve G. Ancak sözcüklere bölme işi, dilin aslında ne kadar ilkel olduğunu ve niye böyle nitelediğimizi anlamanızı sağlayacaktır: yaşamın dili, her zaman 3 harflidir. Yani, yaşamın dilindeki sözcüklere bakacak olursanız, asla 1-2 harfli ya da 3'ten fazla harfli bir sözcük bulamazsınız. Bu dildeki sözcükler, her zaman 3 harflidir. Yani nasıl ki "Hücre bölünmesini başlat!" emrini, Türkçe olarak analiz ettiğimizde 5, 6 ve hatta 11 harfli sözcükleri görebiliyorsak, yukarıda verdiğimiz genetik emir cümlesini ya da proteini (emrin sonucunu) okuyacak olursak, sadece 3 harfli sözcükler kurabiliriz. Şöyle:

ATG AAG TCG ATC CTA GAT GGC CTT GCA GAC ACC ACC TTC CGT ACC ATC ACC ACA GAC CTC…

Daha anlaşılır, değil mi? Eh, "Hücrebölünmesinibaşlat!" yazmaktansa, "Hücre bölünmesini başlat!" yazmakta olduğu gibi... Ancak biz 29 harf ve neredeyse sınırsız sözcük uzunluğumuzla on binlerce kelime türetebiliriz. Ne var ki yaşam, bu 4 harfle ve sadece 3 harf uzunluğundaki sözcüklerle sadece 64 tane sözcük üretebilir. Ancak unutmayın! Bu başka bir dil! Türkçe ya da diğer insan dillerinde sözcüklerin nasıl yan yana geldikleri önemlidir ve her dizilim, anlamlı cümleler oluşturmaz. Örneğin: "Hücre koşuşturmasını uçur!" cümlesinin hiçbir anlamı yokken, "Hücre bölünmesini başlat!" anlamlı bir cümledir. Ne var ki yaşamın dilinde tam olarak böyle değildir: bu 64 sözcük, sınırsız sırada ve sınırsız uzunlukta bir araya gelerek, her seferinde anlamlı, en azından bir ürün verebilecek ifadeler oluşturabilirler. İşte dilin bu özelliği sebebiyle yaşam bu kadar çeşitli olabilmektedir. Unutmayınız ki burada Türkçe analojisi kullanıyor olsak da, bahsettiğimiz diller yapıca ve nitelikçe birbirinden son derece farklı olgulardır. Tabii iki konu arasındaki benzerlikler de aşikar... Bir diğer örnek:

Tüm Reklamları Kapat

Bu dilin içerisinde, "cümle başlangıcı" (aynı "büyük harf" gibi) ve "cümle sonu" (nokta gibi) sözcükler vardır. Örneğin GTC sözcüğü, "Buradan okunmaya başlayacak." anlamına gelebilirken, TAG sözcüğü "Burada okumayı sonlandır." anlamına gelmektedir. Bunu ilkel bir kabilenin tek ses ile çok şey anlatmasına benzetebilirsiniz. Tabii yaşamın dilinde "ses" ile işimiz yok...

İşte bu şekilde, basit bir başlangıçtan, bu kadar güzel ve karmaşık bir yaşam ortaya çıkabilmektedir. Adeta olay yerine sonradan ulaşan detektifler gibi, genleri analiz ettiğimizde, yaşamın evrimsel süreçte nasıl değişerek, nasıl kademeli olarak günümüze ulaştığını anlamamız son derece kolay olmaktadır. Örneğin, gelin bir güve, bir meyve sineği ve bir deniz kabuklusu gibi apayrı canlıların, genetik dizilimlerinin aynı bölgesinden alınan cümlelere bir bakalım:

Güve:

Tüm Reklamları Kapat

GTC GGG CGC GGT CAG TAC TTG GAT GGG TGA CCA CCT GGG AAC ACC GCG TGC CGT TGG…

Güve
Güve
Wikimedia Commons

Meyve Sineği:

GTC GGG CGC GGT TAG TAC TTA GAT GGG GGA CCG CTT GGG AAC ACC GCG TGT TGT TGG…

Meyve Sineği
Meyve Sineği
Wikimedia

Deniz Kabuklusu:

Tüm Reklamları Kapat

Agora Bilim Pazarı
Keep the Aspidistra Flying (George Orwell)

Gordon Comstock has ‘declared war’ on what he sees as an ‘overarching dependence’ on money by leaving a promising job as a copywriter for an advertising company called ‘New Albion’—at which he shows great dexterity—and taking a low-paying job instead, ostensibly so he can write poetry. Coming from a respectable family background in which the inherited wealth has now become dissipated, Gordon resents having to work for a living. The ‘war’ (and the poetry), however, aren’t going particularly well and, under the stress of his ‘self-imposed exile’
from affluence, Gordon has become absurd, petty and deeply neurotic.

Comstock lives without luxuries in a bedsit in London, which he affords by working in a small bookshop owned by a Scot, McKechnie. He works intermittently at a magnum opus he plans to call ‘London Pleasures’, describing a day in London; meanwhile, his only published work, a slim volume of poetry entitled Mice, collects dust on the remainder shelf. He is simultaneously content with his meagre existence and also disdainful of it. He lives without financial ambition and the need for a ‘good job,’ but his living conditions are uncomfortable and his job is boring.

Warning: Unlike most of the books in our store, this book is in English.
Uyarı: Agora Bilim Pazarı’ndaki diğer birçok kitabın aksine, bu kitap İngilizcedir.

Devamını Göster
₺180.00
Keep the Aspidistra Flying (George Orwell)
  • Dış Sitelerde Paylaş

GTC GGG CCC GGT CAG TAC TTG GAT GGG TGA CCG CCT GGG AAC ACC GGG TGC TGT TGG…

Deniz Kabuklusu
Deniz Kabuklusu
Wikipedia

Durmayın, kontrol edin. Arada 1-2 farklılık göreceksiniz. Bu tıpkı, bir kitabın fotokopi ile değil de, el yazması olarak binlerce, milyonlarca defa, olabildiğince özenli ama insani hata sınırlarıyla birlikte kopyalanması sonucunda, birkaç yüz harfte 1-2 defa yapılan hatalara benzemektedir. Ancak bu ufak hatalar, bir araya gelerek ve birikerek, daha da önemlisi bu değişimlerden kaynaklı özellik farklılıklar, içinde bulunulan doğa koşullarına göre seçilerek, günümüze kadar ulaşabilmekte ve türün ayırt edici özelliklerinin oluşmasında ve yeni türlerin evrimleşmesinde görev almaktadırlar.

Burada sorabilirsiniz: "İyi de bir kitaptaki hatalar birikerek neredeyse asla anlamlı bir sözcük oluşturamazlar; bu harfler hatalı kopyalanarak nasıl işe yarar canlılar ve özellikler var edebiliyor?" İşte bunun sebebi bizim konuşma dilimiz ile genlerin dilinin aynı şekilde çalışmamasındandır. Bizim dilimizde "araba" sözcüğünü "hraka" diye yazdığınızda bir anlam ifade etmese de, DNA dilinde harflerin "hatalı" sıralaması da anlamlı sonuçlar yaratabilir. Bunun sebebi kimyasal tepkimelerin kaotik (stokastik) doğasıdır. Ufak değişimler sonucu tamamen değiştirmek zorunda değildir; sonucun gözle tespit bile edilemeyecek miktarda değiştirebilir ve bu da canlılar arasındaki farklılıkları yaratır: boy uzunluğundan tutun da deri rengine kadar. Fakat bunlar evrim değildir, bunlar çeşitliliktir. Bu ufak değişimler, o anda bulunulan çevrenin etkisi altında "seçilir" veya "elenir". Seçilenler hayatta kalır ve ürerler, bu sayede kendilerindeki "hatalı" gen kopyalarını (dillerini) gelecek nesillere aktarırlar. Böylece popülasyon içerisindeki bu hatalar birikir. Ancak bunlara artık "hata" demek doğru değildir, çünkü çevre karşısında fayda sağlamıştır. Bunu tıpkı dilimizde hatalı söylenen sözcüklerin "tutmasından" ötürü yer etmesine benzetebilirsiniz aslında. Örneğin eskiden "kan kardeş" olarak bilinen kalıp, günümüzde "kanka", "panpa", "pampa" gibi birçok sözcükle karşılanabilmektedir. Bunlar dışarıdan bir müdahale ile değişmemiştir, dilin normal gelişimi sırasında değişmiş ve adaptif oldukları için dilde yer etmiştir.

Yaşamın dili tüm canlılarda ortak olsa da, yukarıdaki üç canlının fotoğraflarına bakacak olursanız, tamamen farklı olduklarını göreceksiniz. Farklı görünürler, farklı yaşarlar, farklı davranırlar, farklı eşsiz nitelikleri vardır... Ancak özlerinde, genetik kodlarına baktığımızda, evrimsel sürecin imzasını parlak bir şekilde görürüz. Esasında Dünya tarihinde ve bugününde ele alacağınız her iki tür, her iki birey, evrimsel süreçte birbiriyle mutlaka akrabadır. Ancak bu akrabalık 1. derece kadar yakın olabileceği gibi, yüz bininci derece kadar uzak da olabilir. Baş döndürücü olansa, tıpkı kopyalanan bir kitaptaki hataları takip ederek tarih içerisindeki farklı kopyalara ulaşabilmemiz gibi, türlerin genlerindeki hataları takip ederek, ortak atalara ve akrabalık ilişkilerine ulaşabiliyor olmamızdır.

Bu Makaleyi Alıntıla
Okundu Olarak İşaretle
Evrim Ağacı Akademi: Evrimi Anlamak Yazı Dizisi

Bu yazı, Evrimi Anlamak yazı dizisinin 7. yazısıdır. Bu yazı dizisini okumaya, serinin 1. yazısı olan ""Tesadüf" Geliyor, Kaçın! Bilimde "Şans" ve "Tesadüf" Kavramlarına Yer Yok mu?" başlıklı makalemizden başlamanızı öneririz.

Yazı dizisi içindeki ilerleyişinizi kaydetmek için veya kayıt olun.

EA Akademi Hakkında Bilgi Al
38
0
  • Paylaş
  • Alıntıla
  • Alıntıları Göster
Paylaş
Sonra Oku
Notlarım
Yazdır / PDF Olarak Kaydet
Bize Ulaş
Yukarı Zıpla

İçeriklerimizin bilimsel gerçekleri doğru bir şekilde yansıtması için en üst düzey çabayı gösteriyoruz. Gözünüze doğru gelmeyen bir şey varsa, mümkünse güvenilir kaynaklarınızla birlikte bize ulaşın!

Bu içeriğimizle ilgili bir sorunuz mu var? Buraya tıklayarak sorabilirsiniz.

Soru & Cevap Platformuna Git
Bu İçerik Size Ne Hissettirdi?
  • Tebrikler! 28
  • Bilim Budur! 21
  • Muhteşem! 15
  • Mmm... Çok sapyoseksüel! 14
  • Merak Uyandırıcı! 12
  • İnanılmaz 8
  • Güldürdü 0
  • Umut Verici! 0
  • Üzücü! 0
  • Grrr... *@$# 0
  • İğrenç! 0
  • Korkutucu! 0
Kaynaklar ve İleri Okuma
  • ORNL. İnsan Genom Projesi. (22 Şubat 2019). Alındığı Tarih: 22 Şubat 2019. Alındığı Yer: ORNL | Arşiv Bağlantısı
Tüm Reklamları Kapat

Evrim Ağacı'na her ay sadece 1 kahve ısmarlayarak destek olmak ister misiniz?

Şu iki siteden birini kullanarak şimdi destek olabilirsiniz:

kreosus.com/evrimagaci | patreon.com/evrimagaci

Çıktı Bilgisi: Bu sayfa, Evrim Ağacı yazdırma aracı kullanılarak 19/05/2024 17:28:06 tarihinde oluşturulmuştur. Evrim Ağacı'ndaki içeriklerin tamamı, birden fazla editör tarafından, durmaksızın elden geçirilmekte, güncellenmekte ve geliştirilmektedir. Dolayısıyla bu çıktının alındığı tarihten sonra yapılan güncellemeleri görmek ve bu içeriğin en güncel halini okumak için lütfen şu adrese gidiniz: https://evrimagaci.org/s/390

İçerik Kullanım İzinleri: Evrim Ağacı'ndaki yazılı içerikler orijinallerine hiçbir şekilde dokunulmadığı müddetçe izin alınmaksızın paylaşılabilir, kopyalanabilir, yapıştırılabilir, çoğaltılabilir, basılabilir, dağıtılabilir, yayılabilir, alıntılanabilir. Ancak bu içeriklerin hiçbiri izin alınmaksızın değiştirilemez ve değiştirilmiş halleri Evrim Ağacı'na aitmiş gibi sunulamaz. Benzer şekilde, içeriklerin hiçbiri, söz konusu içeriğin açıkça belirtilmiş yazarlarından ve Evrim Ağacı'ndan başkasına aitmiş gibi sunulamaz. Bu sayfa izin alınmaksızın düzenlenemez, Evrim Ağacı logosu, yazar/editör bilgileri ve içeriğin diğer kısımları izin alınmaksızın değiştirilemez veya kaldırılamaz.

Keşfet
Akış
İçerikler
Gündem
Hızlı
Mantar
Kartal
Gün
Bilgi
Işık Yılı
Bağırsak
Coronavirus
Araştırmacılar
Erkek
Halk Sağlığı
Doktor
Teşhis
Jeoloji
Aslan
Kültür
Virüs
Vaka
Samanyolu Galaksisi
Balina
Gerçek
Evren
Travma
İhtiyoloji
Karbonhidrat
Aklımdan Geçen
Komünite Seç
Aklımdan Geçen
Fark Ettim ki...
Bugün Öğrendim ki...
İşe Yarar İpucu
Bilim Haberleri
Hikaye Fikri
Video Konu Önerisi
Başlık
Gündem
Bugün bilimseverlerle ne paylaşmak istersin?
Bağlantı
Kurallar
Komünite Kuralları
Bu komünite, aklınızdan geçen düşünceleri Evrim Ağacı ailesiyle paylaşabilmeniz içindir. Yapacağınız paylaşımlar Evrim Ağacı'nın kurallarına tabidir. Ayrıca bu komünitenin ek kurallarına da uymanız gerekmektedir.
1
Bilim kimliğinizi önceleyin.
Evrim Ağacı bir bilim platformudur. Dolayısıyla aklınızdan geçen her şeyden ziyade, bilim veya yaşamla ilgili olabilecek düşüncelerinizle ilgileniyoruz.
2
Propaganda ve baskı amaçlı kullanmayın.
Herkesin aklından her şey geçebilir; fakat bu platformun amacı, insanların belli ideolojiler için propaganda yapmaları veya başkaları üzerinde baskı kurma amacıyla geliştirilmemiştir. Paylaştığınız fikirlerin değer kattığından emin olun.
3
Gerilim yaratmayın.
Gerilim, tersleme, tahrik, taciz, alay, dedikodu, trollük, vurdumduymazlık, duyarsızlık, ırkçılık, bağnazlık, nefret söylemi, azınlıklara saldırı, fanatizm, holiganlık, sloganlar yasaktır.
4
Değer katın; hassas konulardan ve öznel yoruma açık alanlardan uzak durun.
Bu komünitenin amacı okurlara hayatla ilgili keyifli farkındalıklar yaşatabilmektir. Din, politika, spor, aktüel konular gibi anlık tepkilere neden olabilecek konulardaki tespitlerden kaçının. Ayrıca aklınızdan geçenlerin Türkiye’deki bilim komünitesine değer katması beklenmektedir.
5
Cevap hakkı doğurmayın.
Bu platformda cevap veya yorum sistemi bulunmamaktadır. Dolayısıyla aklınızdan geçenlerin, tespit edilebilir kişilere cevap hakkı doğurmadığından emin olun.
Ekle
Soru Sor
Sosyal
Yeniler
Daha Fazla İçerik Göster
Popüler Yazılar
30 gün
90 gün
1 yıl
Evrim Ağacı'na Destek Ol

Evrim Ağacı'nın %100 okur destekli bir bilim platformu olduğunu biliyor muydunuz? Evrim Ağacı'nın maddi destekçileri arasına katılarak Türkiye'de bilimin yayılmasına güç katın.

Evrim Ağacı'nı Takip Et!
Yazı Geçmişi
Okuma Geçmişi
Notlarım
İlerleme Durumunu Güncelle
Okudum
Sonra Oku
Not Ekle
Kaldığım Yeri İşaretle
Göz Attım

Evrim Ağacı tarafından otomatik olarak takip edilen işlemleri istediğin zaman durdurabilirsin.
[Site ayalarına git...]

Filtrele
Listele
Bu yazıdaki hareketlerin
Devamını Göster
Filtrele
Listele
Tüm Okuma Geçmişin
Devamını Göster
0/10000
Bu Makaleyi Alıntıla
Evrim Ağacı Formatı
APA7
MLA9
Chicago
Ç. M. Bakırcı. DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!. (19 Mart 2014). Alındığı Tarih: 19 Mayıs 2024. Alındığı Yer: https://evrimagaci.org/s/390
Bakırcı, Ç. M. (2014, March 19). DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!. Evrim Ağacı. Retrieved May 19, 2024. from https://evrimagaci.org/s/390
Ç. M. Bakırcı. “DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!.” Edited by Çağrı Mert Bakırcı. Evrim Ağacı, 19 Mar. 2014, https://evrimagaci.org/s/390.
Bakırcı, Çağrı Mert. “DNA ve Evrim: Yaşamın Dilini Okuyup, Anlamayı Öğrenin!.” Edited by Çağrı Mert Bakırcı. Evrim Ağacı, March 19, 2014. https://evrimagaci.org/s/390.
ve seni takip ediyor

Göster

Şifremi unuttum Üyelik Aktivasyonu

Göster

Şifrenizi mi unuttunuz? Lütfen e-posta adresinizi giriniz. E-posta adresinize şifrenizi sıfırlamak için bir bağlantı gönderilecektir.

Geri dön

Eğer aktivasyon kodunu almadıysanız lütfen e-posta adresinizi giriniz. Üyeliğinizi aktive etmek için e-posta adresinize bir bağlantı gönderilecektir.

Geri dön

Close