Bu Reklamı Kapat
Sorulara Dön
Zizigom Mx
Zizigom Mx Üye

Atttgggggccccatgcccccccstgggatcccgattagtccaggatcgga kesim bölgelerini, söz konusu enzimlerin tanıma dizilerini ve pozisyonlarını vererek belirtiniz?

Aşağıda tek zincirinde nükleotitlerin dizilimi verilen DNA üzerindeki restriksiyon endonukleaz enzimlerinin kesim bölgelerinin, söz konusu enzimlerin tanıma dizilerini ve pozisyonlarını vererek belirtin. ATTTGGGGGCCCCATGCCCCCCCSTGGGATCCCGATTAGTCCAGGATCGGA
  • Soruyu Takip Et
  • Raporla
Cevap Ver
İlginizi Çekebilecek Sorular
Evrim Ağacı Soru & Cevap Platformu, Türkiye'deki bilimseverler tarafından kolektif ve öz denetime dayalı bir şekilde sürdürülen, özgür bir ortamdır. Evrim Ağacı tarafından yayınlanan makalelerin aksine, bu platforma girilen soru ve cevapların içeriği veya gerçek/doğru olup olmadıkları Evrim Ağacı yönetimi tarafından denetlenmemektedir. Evrim Ağacı, bu platformda yayınlanan cevapları herhangi bir şekilde desteklememekte veya doğruluğunu garanti etmemektedir. Doğru olmadığını düşündüğünüz cevapları, size sunulan denetim araçlarıyla işaretleyebilir, daha doğru olan cevapları kaynaklarıyla girebilir ve oylama araçlarıyla platformun daha güvenilir bir ortama evrimleşmesine katkı sağlayabilirsiniz.
Sorulara Dön
Evrim Ağacı'na Destek Ol
Evrim Ağacı'nın %100 okur destekli bir bilim platformu olduğunu biliyor muydunuz? Evrim Ağacı'nın maddi destekçileri arasına katılarak Türkiye'de bilimin yayılmasına güç katmak için hemen buraya tıklayın.
Popüler Yazılar
30 gün
90 gün
1 yıl
EA Akademi
Evrim Ağacı Akademi (ya da kısaca EA Akademi), 2010 yılından beri ürettiğimiz makalelerden oluşan ve kendi kendinizi bilimin çeşitli dallarında eğitebileceğiniz bir çevirim içi eğitim girişimi! Evrim Ağacı Akademi'yi buraya tıklayarak görebilirsiniz. Daha fazla bilgi için buraya tıklayın.
Etkinlik & İlan
Bilim ile ilgili bir etkinlik mi düzenliyorsunuz? Yoksa bilim insanlarını veya bilimseverleri ilgilendiren bir iş, staj, çalıştay, makale çağrısı vb. bir duyurunuz mu var? Etkinlik & İlan Platformumuzda paylaşın, milyonlarca bilimsevere ulaşsın.
Evrim Ağacı'nın birçok içeriğinin profesyonel ses sanatçıları tarafından seslendirildiğini biliyor muydunuz? Bunların hepsini Podcast Platformumuzda dinleyebilirsiniz. Ayrıca Spotify, iTunes, Google Podcast ve YouTube bağlantılarını da bir arada bulabilirsiniz.


Şifremi unuttum Üyelik Aktivasyonu


Şifrenizi mi unuttunuz? Lütfen e-posta adresinizi giriniz. E-posta adresinize şifrenizi sıfırlamak için bir bağlantı gönderilecektir.

Geri dön

Eğer aktivasyon kodunu almadıysanız lütfen e-posta adresinizi giriniz. Üyeliğinizi aktive etmek için e-posta adresinize bir bağlantı gönderilecektir.

Geri dön

Geri Bildirim Gönder
Reklamsız Deneyim

Evrim Ağacı'nda reklamları 2 şekilde kapatabilirsiniz:

  1. Ücretsiz üye girişi yapmak: Sitedeki reklamların %50 kadarını kapatmak için ücretsiz bir Evrim Ağacı üyeliği açmanız ve sitemizi/uygulamamızı kullanmanız yeterli!

  2. Maddi destekçilerimiz arasına katılmak: Evrim Ağacı'nın çalışmalarına Kreosus, Patreon veya YouTube üzerinden maddi destekte bulunarak hem Türkiye'de bilim anlatıcılığının gelişmesine katkı sağlayabilirsiniz, hem de site ve uygulamamızı reklamsız olarak deneyimleyebilirsiniz. Reklamsız deneyim, sitemizin/uygulamamızın çeşitli kısımlarda gösterilen Google reklamlarını ve destek çağrılarını görmediğiniz, %100 reklamsız ve çok daha temiz bir site deneyimi sunmaktadır.


Kreosus'ta her 10₺'lik destek, 1 aylık reklamsız deneyime karşılık geliyor. Bu sayede, tek seferlik destekçilerimiz de, aylık destekçilerimiz de toplam destekleriyle doğru orantılı bir süre boyunca reklamsız deneyim elde edebiliyorlar.

Kreosus destekçilerimizin reklamsız deneyimi, destek olmaya başladıkları anda devreye girmektedir ve ek bir işleme gerek yoktur.


Patreon destekçilerimiz, destek miktarından bağımsız olarak, Evrim Ağacı'na destek oldukları süre boyunca reklamsız deneyime erişmeyi sürdürebiliyorlar.

Patreon destekçilerimizin Patreon ile ilişkili e-posta hesapları, Evrim Ağacı'ndaki üyelik e-postaları ile birebir aynı olmalıdır. Patreon destekçilerimizin reklamsız deneyiminin devreye girmesi 24 saat alabilmektedir.


YouTube destekçilerimizin hepsi otomatik olarak reklamsız deneyime şimdilik erişemiyorlar ve şu anda, YouTube üzerinden her destek seviyesine reklamsız deneyim ayrıcalığını sunamamaktayız. YouTube Destek Sistemi üzerinde sunulan farklı seviyelerin açıklamalarını okuyarak, hangi ayrıcalıklara erişebileceğinizi öğrenebilirsiniz.

Eğer seçtiğiniz seviye reklamsız deneyim ayrıcalığı sunuyorsa, destek olduktan sonra YouTube tarafından gösterilecek olan bağlantıdaki formu doldurarak reklamsız deneyime erişebilirsiniz. YouTube destekçilerimizin reklamsız deneyiminin devreye girmesi, formu doldurduktan sonra 24-72 saat alabilmektedir.

Diğer Platformlar

Bu 3 platform haricinde destek olan destekçilerimize ne yazık ki reklamsız deneyim ayrıcalığını sunamamaktayız. Destekleriniz sayesinde sistemlerimizi geliştirmeyi sürdürüyoruz ve umuyoruz bu ayrıcalıkları zamanla genişletebileceğiz.

Giriş yapmayı unutmayın!

Reklamsız deneyim için, maddi desteğiniz ile ilişkilendirilmiş olan Evrim Ağacı hesabınıza yapmanız gerekmektedir. Giriş yapmadığınız takdirde reklamları görmeye devam edeceksinizdir.

Destek Ol

Devamını Oku
Evrim Ağacı Uygulamasını
Chromium Tabanlı Mobil Tarayıcılar (Chrome, Edge, Brave vb.)
İlk birkaç girişinizde zaten tarayıcınız size uygulamamızı indirmeyi önerecek. Önerideki tuşa tıklayarak uygulamamızı kurabilirsiniz. Bu öneriyi, yukarıdaki videoda görebilirsiniz. Eğer bu öneri artık gözükmüyorsa, Ayarlar/Seçenekler (⋮) ikonuna tıklayıp, Uygulamayı Yükle seçeneğini kullanabilirsiniz.
Chromium Tabanlı Masaüstü Tarayıcılar (Chrome, Edge, Brave vb.)
Yeni uygulamamızı kurmak için tarayıcı çubuğundaki kurulum tuşuna tıklayın. "Yükle" (Install) tuşuna basarak kurulumu tamamlayın. Dilerseniz, Evrim Ağacı İleri Web Uygulaması'nı görev çubuğunuza sabitleyin. Uygulama logosuna sağ tıklayıp, "Görev Çubuğuna Sabitle" seçeneğine tıklayabilirsiniz. Eğer bu seçenek gözükmüyorsa, tarayıcının Ayarlar/Seçenekler (⋮) ikonuna tıklayıp, Uygulamayı Yükle seçeneğini kullanabilirsiniz.
Safari Mobil Uygulama
Sırasıyla Paylaş -> Ana Ekrana Ekle -> Ekle tuşlarına basarak yeni mobil uygulamamızı kurabilirsiniz. Bu basamakları görmek için yukarıdaki videoyu izleyebilirsiniz.

Daha fazla bilgi almak için tıklayın

Görseli Kaydet
Bu Eseri Neden Tavsiye Ediyorsun?
Aşağıdaki kutuya, isimli neden tavsiye ettiğini girebilirsin. Ne kadar detaylı ve kapsamlı bir analiz yaparsan, bu eseri [OKUMAK/İZLEMEK] isteyenleri o kadar doğru ve fazla bilgilendirmiş olacaksın. Tavsiyenin faydalı bulunması halinde Evrim Ağacı kullanıcılarından daha fazla UP kazanman mümkün olacak. Tavsiyenin sadece negatif içerikte olamayacağını, eğer bu sistemi kullanıyorsan tavsiye ettiğin içeriğin pozitif taraflarından bahsetmek zorunda olduğunu lütfen unutma. Yapıcı eleştiri hakkında daha fazla bilgi almak için burayı okuyabilirsin.
Tavsiye Et